Página Inicial

Produtos

Solicite seu Catálogo

Eventos/Feiras

Loja Online

Downloads  

Oligo-RP

  (11) 3464 8900
  Este endereço de email está sendo protegido de spambots. Você precisa do JavaScript ativado para vê-lo.

logo_pheno.png

Untitled-1.png

Colunas de HPLC Clarity® Oligo-RP™

Otimize a Purificação e Análise  com a
coluna Clarity® Oligo-RP™

Separação de  N-1 a partir do oligo alvo com  > 90 % de pureza

Metodologia LC/MS que maximiza a sensibilidade e a resolução

Colunas disponíveis: Minibore, Analítica, Semi Preparativa e Preparativa

 

Purificação de DNA com falha N-1
a partir do alvo sequência N

Coluna: Clarity 3 µm Oligo-RP C18

Untitled-2.png

Clarity Oligo-RP separa com sucesso o DNA oligonucleotídeo

40mer de 39mer devido a excelente eficiência e poder de resolução

Dimensões: 50 x 4,6 mm
Referência: 00B-4441-E0
Fase Móvel: A: 50 mM TEAA pH 7,5
  B: Metanol
Gradiente: 10 % para 45 % B em 30 minutos
Fluxo: 1 mL/ min
Detector:
UV em 260 nm
Amostra: 1. 40nt DNA com sequência
  CTTCTGAACAGTTGATCTATGC
  ACTTCAGACTTATGATCA (2,5 µg)
  2. 39nt DNA com sequência
  TTCTGAACAGTTGATCTAT

 

 

Compartilhe este Link
Entre em Contato
Central DDR
(11)  3464 8900
WhatsApp
(11) 9 7159 5896

 

CERTIFICADO ISO 9001

CERTIFICADO ISO 9001

Receba nossas novidades